Sequence and secondary structure of Porphyra umbilicalis 5S rRNA. Relevance for the evolutionary origin of red algae.
نویسندگان
چکیده
This pattern can be explained by assuming that the ancestral, eukaryotic 5S rRNA shared the first two features with the archaebacterlal and eubacterial 5S rRNAs, and that these were altered in the eukaryotic branch of evolution only after the divergence of the red algae, the latter conserving these ancestral features until the present time. As such, the study of 5S rRNA secondary structure consolidates phylogenetic studies (4) based on 5S rRNA sequences and pointing to the red algae as the earliest diverging branch of the eukaryotes.
منابع مشابه
The nucleotide sequences of 5S rRNAs from two red algae, Gracilaria compressa and Porphyra tenera.
The nucleotide sequences of 5S rRNA from two red algae, Gracilaria compressa and Porphyra tenera have been determined. The two 5S rRNAs are fairly dissimilar to each other in their sequences (65% identity), although they are both composed of 121 nucleotides. Their secondary structures are generally of the eukaryotic with a prokaryotic characteristic. Judged from the 5S rRNA sequence data, the r...
متن کاملThe nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.
The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).
متن کاملAnalysis of Porphyra membrane transporters demonstrates gene transfer among photosynthetic eukaryotes and numerous sodium-coupled transport systems.
Membrane transporters play a central role in many cellular processes that rely on the movement of ions and organic molecules between the environment and the cell, and between cellular compartments. Transporters have been well characterized in plants and green algae, but little is known about transporters or their evolutionary histories in the red algae. Here we examined 482 expressed sequence t...
متن کاملNucleotide sequence of cytoplasmic 5S rRNA from a eukaryotic thermophilic unicellular alga, Cyanidium caldarium.
From a total RNA extract of Cyanidium caldarium (Cca) cells we isolated, by the use of polyacrylamide gel electrophoresis under denaturing conditions, cytoplasmic 5S rRNA and determined its primary and possible secondary structure (Figure 1). The Cca 5S rRNA (i) is 124 nt long, (ii) harbors, at the expected positions, both internal transcription signals characteristic of this class of RNA polym...
متن کاملInsights into the red algae and eukaryotic evolution from the genome of Porphyra umbilicalis (Bangiophyceae, Rhodophyta).
Porphyra umbilicalis (laver) belongs to an ancient group of red algae (Bangiophyceae), is harvested for human food, and thrives in the harsh conditions of the upper intertidal zone. Here we present the 87.7-Mbp haploid Porphyra genome (65.8% G + C content, 13,125 gene loci) and elucidate traits that inform our understanding of the biology of red algae as one of the few multicellular eukaryotic ...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید
ثبت ناماگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید
ورودعنوان ژورنال:
- Nucleic acids research
دوره 16 22 شماره
صفحات -
تاریخ انتشار 1988